Vizualizarea Similitudinii DNA-ului Uman și Chimic

Sursă Originală: http://www.cs.ucr.edu/~eamonn/DNA/

Eamonn Keogh ,  Stefano Lonardi , Victor B. Zordan , Sang-Hee Lee și Manel Jara.

Universitatea din California – Riverside 
Riverside, CA 92521

Publicarea recentă a genomului complet de cimpanzeu, marcată de o emisiune a revistei Nature , ne spune că oamenii și cimpanzeii au 96% din același material genetic. Acest număr este greu de înțeles, ce anume înseamnă să spunem că împărțim 96% din ADN-ul nostru cu cei mai apropiați veri vii?

Explorarea directă a ADN-ului nu este de ajutor. De exemplu, luați în considerare primele 100 de perechi de bază ale cimpului ADN mitocondrial :

 gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcaccccataaacaaacaggtttggtcctagcctttctattag …

și primele 100 de perechi de bază ale ADN-ului mitocondrial uman:

gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtattttcgtctggggggtgtgcacgcgatagcattgcgagacgctg …

Este foarte dificil de evaluat similitudinea, iar genomul complet atât pentru om cât și pentru cimpanzeu este de fapt aproximativ 3 miliarde de perechi de baze lungi!  

Am construit o unealtă simplă pentru a permite oamenilor să vizualizeze și să înțeleagă asemănarea / disimilaritatea secvențelor ADN. În timp ce această lucrare este în prezent nepublicată și încă în curs de desfășurare, am lansat un videoclip despre ADN-ul uman și cimpanzeu care să coincidă cu publicarea genomului complet al cimpanzei.

Videoclipul durează aproximativ 2 minute și este complet autonom. Mai jos este versiunea în Youtube, puteți prefera să vedeți versiunile standalone cu rezoluție mult mai ridicată de mai jos.

  • Versiunea video Google este aici .
  • Redați versiunea Quicktime în browser: Atenție, cea mai bună calitate, dar fișier mare. Pot dura câteva minute înainte de redarea videoclipurilor. 
  • Redați versiunea AVI în browser.
  • Redați versiunea MP4 în browser. 
  • Faceți clic dreapta pentru a descărca versiunea Quicktime : Atenție, fișier mare ( player gratuit ).
  • Faceți clic dreapta pentru a descărca versiunea AVI
  • Faceți clic dreapta pentru a descărca versiunea MP4

Scurtă biografie a participanților:

  • Dr. Eamonn Keogh este profesor asistent de informatică la UCR . Interesele sale de cercetare includ extracția de date și vizualizarea.
  • Dr. Stefano Lonardi este profesor asistent de informatică la UCR . Interesele sale de cercetare includ biologie moleculară computațională.
  • Dr. Victor B. Zordan este profesor asistent de informatică la UCR . Interesele sale de cercetare includ grafica pe calculator.
  • Dr. Sang-Hee Lee este profesor asistent de antropologie la UCR . Interesele sale de cercetare includ evoluția umană și taxonomia.
  • Manel Jara este student la Universitatea Autonomă din Barcelona și a fost student la UCR în 2005.

Dacă doriți să menționați această lucrare, vă rugăm să folosiți:

E. Keogh, S. Lonardi, VB Zordan, SH Lee și M. Jara (2005). Vizualizarea similitudinii ADN-ului uman și chimic . (Multimedia Video). http://www.cs.ucr.edu/~eamonn/DNA/

Mulțumită lui Colin Crenshaw, Bill Yuan-chi Chiu și Anwar Adi pentru ajutor și sugestii. Muzica din videoclip este Chopin – Ballade No. 4 in f minor, Op.52, Andante con moto, interpretat de Dr. Sang-Hee Lee .